0,00 €*
Positionen anzeigen
 
 
Zurück
Vor
GFP-targeting guide RNA for CRISPR

GFP-targeting guide RNA for CRISPR

Gewicht

Hersteller Genaxxon bioscience



Artikel-Nr.: P2008.0010

shipped on wet ice, store at -20°C

 

Lieferzeit - bitte wenden Sie sich an Genaxxon

57,50 € *
 
 
 
 
 

Produktinformationen "GFP-targeting guide RNA for CRISPR"

Purified gRNA, which targets sequences encoding green-fluorescent protein (GFP), or enhanced GFP.
This GFP-targeting gRNA may serve as a positive control in down-stream assays, monitoring the success of CRISPR/Cas9 genome editing experiments.  All you need is a cell line stably expressing one copy of (E)GFP. If your transfection conditions and CRISPR/Cas9 components are working, the GFP locus will be mutated. The resulting loss of GFP fluorescence can be easily determined by flow cytometry analysis. Alternatively, analysis of the DNA will reveal mutations in the GFP locus.

 

Applikation:

targeting of gRNA for CRISPR
 
 

Technische Daten:

Sequence: 5'-(GG)N20GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3'
The spacer sequence N20 is customized to target your gene-of-interest. It is followed by the constant structural part of the gRNA, which includes the tracr RNA, and was optimized according to Chen et al. (2013, Cell 155: 1479-1491) for improved stability of the gRNA and more efficient assembly with the Cas9 protein.
The two guanines in parentheses on the 5' end are added if they are not part of the spacer sequence.

Applikation:

targeting of gRNA for CRISPR

Quelle

synthetic

Sicherheits Hinweise / Safety

Klassifizierungen / Classification

eclass-Nr: 25-09-90-90

Dokumente - Protokolle - Downloads

 
 
 

Kundenbewertungen für "GFP-targeting guide RNA for CRISPR"

 
Bewertungen werden nach Überprüfung freigeschaltet.

Bewertung schreiben

 
 
 
 
 
 
 

Die mit einem * markierten Felder sind Pflichtfelder.

 
 
esiCRISPR Kit-wt

550,00 € *

Cas9-Dead-NLS

ab 195,00 € *

Cas9-Nickase-NLS

ab 195,00 € *

Cas9-NLS-tagRFP - Cas9 with red...

ab 215,00 € *

DAF-2 / 4,5-Diaminofluorescein -...

144,69 € * Statt: 222,60 € *

LyoBeads - vorportioniert in...

ab 0,01 € *

LyoCake - Lyophilisierter qPCR...

ab 25,00 € *

Cas9-Dead-NLS-EGFP

ab 215,00 € *

MOG (35-55) Ratte/Maus -...

319,56 € * Statt: 375,95 € *

Gentamycinsulfat, 10 mg/mL -...

ab 35,66 € * Statt: 44,57 € *

rek. humanes Serumalbumin (rHSA)

ab 242,55 € *

SSC Puffer (20X) Lösung - 1L

50,36 € *

Doxycyclin - Hyclat

ab 28,72 € *

CentriPure P2 Säulchen für die...

ab 11,62 € *

GreenMasterMix (2X) High ROX für...

ab 20,00 € * Statt: 75,00 € *

Taq DNA Polymerase S (Hohe...

ab 0,01 € * Statt: 15,00 € *

D-TAT (47-57) ygrkkrrqrrr-NH2

ab 263,37 € *

Arg9 (R9)

ab 141,25 € *

Influenza A NP (366-374) -...

ab 145,23 € *

qshyrhispaqv (D-Aminosäuren)

ab 190,04 € *

KLVFF

ab 145,23 € *

Biotinyliertes Amyloid-beta...

ab 431,63 € *

Kontrollpeptid Amyloid-beta...

ab 220,60 € *

Kontrollpeptid Amyloid-beta...

ab 220,60 € *