0,00 €*
Positionen anzeigen
 
 
Zurück
single guide RNA - custom made

single guide RNA - custom made

Gewicht

Hersteller Genaxxon bioscience



Artikel-Nr.: P2007.0020

shipped on wet ice, store at -20°C

CAS-Nr: 63231-63-0
 

Lieferzeit - bitte wenden Sie sich an Genaxxon

121,50 € *
 
 
 
 
 

Produktinformationen "single guide RNA - custom made"

The design and synthesis of guide RNA requires expertise and experience, and is time-consuming!

If you need high-quality custom made guide RNA (gRNA) as a tool for your CRISPR/Cas9 experiment, don't worry. Genaxxon bioscience offers ready-to-transfect gRNA for its customers. These guide RNAs are combined crRNA and tracrRNAs, so each guide RNA is a single RNA molecule of about 100 nt. Our gRNA sequences fold into an optimized scaffold with increased stability and improved assembly with Cas9 proteins in comparison with earlier generation single gRNA sequences (Cell 155: 1479-1491).

To order your custom gRNA, you may either provide the specific gRNA targeting-sequence (20 nt), or the sequence of the gene you want to target. In the latter case, Genaxxon will identify the most suitable region in that gene for effective gRNA targeting free of charge.

The standard order size is 20µg, but larger sizes are available upon request.

Quality control: The gRNAs are designed based on the algorithms by Doench et al. (2014, Nature Biotechnology 32: 1262-1267) and Moreno-Mateos et al. (2015, Nature Methods 12: 982-988). The quality of each synthesized gRNA is checked via gel electrophoresis, and the concentration is determined by measuring A260. Each gRNA must pass a cell toxicity test.

Concentration: The standard concentration is 400 ng/µL in water. Custom concentrations are possible.

 
 
 

Technische Daten:

Sequence: 5'-(GG)N20GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3'
The spacer sequence N20 is customized to target your gene-of-interest. It is followed by the constant structural part of the gRNA, which includes the tracr RNA, and was optimized according to Chen et al. (2013, Cell 155: 1479-1491) for improved stability of the gRNA and more efficient assembly with the Cas9 protein.
The two guanines in parentheses on the 5' end are added if they are not part of the spacer sequence.

Quelle

synthetic

Sicherheits Hinweise / Safety

Klassifizierungen / Classification

EC-Nr: 277-256-7
CAS-Nr: 63231-63-0
eclass-Nr: 25-09-90-90

Dokumente - Protokolle - Downloads

Hier finden Sie Infos und weiterführende Literatur zu single guide RNA - custom made

   Zertifikate

 
 
 

Kundenbewertungen für "single guide RNA - custom made"

 
Bewertungen werden nach Überprüfung freigeschaltet.

Bewertung schreiben

 
 
 
 
 
 
 

Die mit einem * markierten Felder sind Pflichtfelder.

 
 
CRISPRfect E...

120,00 € *

esiCRISPR Kit-wt

550,00 € *

Cas9-Dead-NLS

ab 195,00 € *

Cas9-NLS-tagRFP - Cas9 mit rot...

ab 215,00 € *

esiRNA - Positive Controls

ab 145,00 € *

Cas9-NLS-EGFP

ab 215,00 € *

LyoBeads - vorportioniert in...

ab 0,01 € *

Cas9-Nickase-NLS

ab 195,00 € *

esiRNA - Negative Controls

ab 145,00 € *

Taq DNA Polymerase S (Hohe...

ab 0,01 € * Statt: 15,00 € *

Lambda-DNA - Hind III DNA Marker...

5,00 € * Statt: 19,50 € *

TBS mit Tween®20, pH7.6 -...

10,00 € * Statt: 61,93 € *

Pipettenspitzen 1-200µL, nicht...

20,00 € * Statt: 45,00 € *

Nuclease-Free Water

ab 39,00 € *

8-cap strips, 300 strips -...

35,00 € * Statt: 98,58 € *

Bis-Tris, p.A. - Sonderposten

65,00 € * Statt: 226,90 € *