GFP-targeting guide RNA for CRISPR

GFP-targeting guide RNA for CRISPR


Artikel-Nr.: P2008.0010

Shipping: shipped on wet ice, store at -20°C

Lieferzeit: normalerweise 3 - 8 Werktage - Bitte wenden Sie sich an Genaxxon

82,95 € *

Gewicht:

Wählen Sie bitte die gewünschte Packungsgröße aus.

GFP-targeting guide RNA for CRISPR is purified gRNA, which targets sequences encoding... mehr
Produktinformationen "GFP-targeting guide RNA for CRISPR"

GFP-targeting guide RNA for CRISPR is purified gRNA, which targets sequences encoding green-fluorescent protein (GFP), or enhanced GFP.
This GFP-targeting gRNA may serve as a positive control in down-stream assays, monitoring the success of CRISPR/Cas9 genome editing experiments.  All you need is a cell line stably expressing one copy of (E)GFP. If your transfection conditions and CRISPR/Cas9 components are working, the GFP locus will be mutated. The resulting loss of GFP fluorescence can be easily determined by flow cytometry analysis. Alternatively, analysis of the DNA will reveal mutations in the GFP locus.

Cas9-NLS-Proteine von Genaxxon: Cas9-NLS (Nuklease, Wildtyp) >, Cas9-NLS-tagRFP (Nuklease mit rot fluoreszierendem Proteinmarker) >, Cas9-Dead-NLS >, Cas9-Dead-NLS-EGFP >.

Transfektionsreagenz für die Co-Transfektions RNA/Protein, speziell entwickelt für den Einsatz in CRISPR/Cas9-Systemen: CRISPRfect E >.

Weitere Artikel passend zu "GFP-targeting guide RNA for CRISPR"
Sequence: 5'-(GG) N20... mehr
 

Technische Daten:

Sequence: 5'-(GG)N20GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3'
The spacer sequence N20 is customized to target your gene-of-interest. It is followed by the constant structural part of the gRNA, which includes the tracr RNA, and was optimized according to Chen et al. (2013, Cell 155: 1479-1491) for improved stability of the gRNA and more efficient assembly with the Cas9 protein.
The two guanines in parentheses on the 5' end are added if they are not part of the spacer sequence.

Applikation:

targeting of gRNA for CRISPR

Quelle

synthetic

Sicherheits Hinweise / Safety

Klassifizierungen / Classification

eclass-Nr: 25-09-90-90
Dokumente - Protokolle - Downloads mehr

Dokumente - Protokolle - Downloads

Hier finden Sie Informationen und weiterführende Literatur zu GFP-targeting guide RNA for CRISPR. Für weitere Dokumente (Zertifikate mit weiteren Lotnummern, Sicherheitsdatenblätter in anderer Sprache, weitere Produktinformationen) wenden Sie sich bitte an Genaxxon biosience unter: info@genaxxon.com oder Tel.: +49 731 3608 123.

 
 
 
Bewertungen lesen, schreiben und diskutieren... mehr
Kundenbewertungen für "GFP-targeting guide RNA for CRISPR"
Bewertung schreiben
Bewertungen werden nach Überprüfung freigeschaltet.
Bitte geben Sie die Zeichenfolge in das nachfolgende Textfeld ein.

Die mit einem * markierten Felder sind Pflichtfelder.

Cas9-NLS-EGFP Cas9-NLS-EGFP
ab 270,90 € *
Cas9-Dead-NLS-EGFP Cas9-Dead-NLS-EGFP
ab 270,90 € *
Cas9-Nickase-NLS Cas9-Nickase-NLS
ab 245,70 € *
esiCRISPR Kit-wt esiCRISPR Kit-wt
577,50 € *
Cas9-Dead-NLS Protein Cas9-Dead-NLS Protein
ab 245,70 € *
TIPP!
Premium dNTPs at low prices dNTP-Set (Na-Salz) - 100 mM Lösung
ab 30,00 € * 50,00 € *
L-Asparaginase L-Asparaginase
ab 176,02 € *
Colcemid - chemical structure Colcemid - 10mL
11,91 € *
Etoposid - chemical structure Etoposid
ab 274,79 € *
Herbimycin A Herbimycin A
ab 338,16 € *
AEBSF Inhibitor chemical structure AEBSF Hydrochlorid
ab 46,15 € *