single guide RNA - custom made

single guide RNA - custom made


Artikel-Nr.: P2007.0020

Shipping: shipped on wet ice, store at -20°C
CAS-Nr: 63231-63-0

Lieferzeit: normalerweise 3 - 8 Werktage - Bitte wenden Sie sich an Genaxxon

145,80 € *

Gewicht:

Wählen Sie bitte die gewünschte Packungsgröße aus.

The design and synthesis of single guide RNA requires expertise and experience, and is... mehr
Produktinformationen "single guide RNA - custom made"

The design and synthesis of single guide RNA requires expertise and experience, and is time-consuming! 

If you need high-quality custom made guide RNA (gRNA) as a tool for your CRISPR/Cas9 experiment, don't worry. Genaxxon bioscience offers ready-to-transfect gRNA for its customers. These guide RNAs are combined crRNA and tracrRNAs, so each guide RNA is a single RNA molecule of about 100 nt. Our gRNA sequences fold into an optimized scaffold with increased stability and improved assembly with Cas9 proteins in comparison with earlier generation single gRNA sequences (Cell 155: 1479-1491 >).

To order your custom gRNA, you may either provide the specific gRNA targeting-sequence (20 nt), or the sequence of the gene you want to target. In the latter case, Genaxxon will identify the most suitable region in that gene for effective gRNA targeting free of charge.

The standard order size is 20µg, but larger sizes are available upon request.

Quality control: The gRNAs are designed based on the algorithms by Doench et al. (2014, Nature Biotechnology 32: 1262-1267) and Moreno-Mateos et al. (2015, Nature Methods 12: 982-988). The quality of each synthesized gRNA is checked via gel electrophoresis, and the concentration is determined by measuring A260. Each gRNA must pass a cell toxicity test.

Concentration: The standard concentration is 400 ng/µL in water. Custom concentrations are possible.

Weitere Artikel passend zu "single guide RNA - custom made"
Sequence: 5'-(GG) N20... mehr
 

Technische Daten:

Sequence: 5'-(GG)N20GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3'
The spacer sequence N20 is customized to target your gene-of-interest. It is followed by the constant structural part of the gRNA, which includes the tracr RNA, and was optimized according to Chen et al. (2013, Cell 155: 1479-1491) for improved stability of the gRNA and more efficient assembly with the Cas9 protein.
The two guanines in parentheses on the 5' end are added if they are not part of the spacer sequence.

Quelle

synthetic

Sicherheits Hinweise / Safety

Klassifizierungen / Classification

EC-Nr: 277-256-7
CAS-Nr: 63231-63-0
eclass-Nr: 25-09-90-90
Dokumente - Protokolle - Downloads mehr

Dokumente - Protokolle - Downloads

Hier finden Sie Infos und weiterführende Literatur zu single guide RNA - custom made

 
 
 
Bewertungen lesen, schreiben und diskutieren... mehr
Kundenbewertungen für "single guide RNA - custom made"
Bewertung schreiben
Bewertungen werden nach Überprüfung freigeschaltet.
Bitte geben Sie die Zeichenfolge in das nachfolgende Textfeld ein.

Die mit einem * markierten Felder sind Pflichtfelder.

NEU
Cas9-Dead-NLS-EGFP Cas9-Dead-NLS-EGFP
ab 258,00 € *
Cas9-Dead-NLS Protein Cas9-Dead-NLS Protein
ab 234,00 € *
esiCRISPR Kit-wt esiCRISPR Kit-wt
550,00 € *
Cas9-NLS-EGFP Cas9-NLS-EGFP
ab 258,00 € *
Cas9-Nickase-NLS Cas9-Nickase-NLS
ab 234,00 € *
TIPP!
Taq Polymerase from Genaxxon Taq DNA Polymerase S (Hohe Genauigkeit)
ab 10,00 € * 25,00 € *
TIPP!
Dermcidin, DCD-1 (SSLLEKGLDGAKKAVGGLGKLGKDAVEDLESVGKGAVHDVKDVLDSV) Dermcidin, DCD-1...
ab 365,00 € *